For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:101897831-101897957 127bp GGAGAAAAGTCTATCTCACAGGTAATC CGAACTCACAGAGGACTTTCAG
Mut = 118 bp
Wt = 127 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TGTTCCGTTCTGTTAGAAGTATATGAAGAATAATCTGGAAATAAACCACTCCAGCAATGGCTTCCAGCATTTCTGAAGCTTGGatatggtctaagatgaatattataccagattctggctaatagcggttgatgcagtaaggtgtcccagtctgggctgtatacaagactaatttagttcactgcatatattgctgtctgtggcctaaattgtcccctttctgtttcttcctttctttttcttgtagtggtttttaattgccaaccgatcttacaaagtcagcgcggccagctcctctttcttcagtggtgtgtttgttggtgttatctcctttggtcagctttcagatcgatttggaaggagaaaagtctatctcacaggtaatctgtcgccatatgcatacactgaataagaggctttattttcccaggactgttatggaaatactaaggggGGGTTATTTTCTGAAAGTCCTCTGTGAGTTCGCAGGTGGACAGAGAG
This mutation is a 371 bp deletion beginning at Chromosome 3 position 101,897,863 bp and ending after 101,898,233 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52162 | CGA ACT CAC AGA GGA CTT TCA G | Common | A | |||
| 52163 | GGA GAA AAG TCT ATC TCA CAG GTA ATC | Wild type Forward | A | |||
| 52164 | CTG TGT TCC GTT CTG TTA GAA GT | Mutant Forward | A | |||
| 52165 | Fluorophore-1 | CCA TAT GCA TAC ACT GAA TAA GAG GCT | Quencher-1 | WT Probe | ||
| 52166 | Fluorophore-2 | TCC AGC ATT TCT GAA GCT TGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52162 | 0.40 uM |
| 52163 | 0.40 uM |
| 52164 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.