Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr3:95624861+95624963 103bp TGCCTGTCGCTCTAAAGAATC CCTCCTATGAGAGCCAATGAG
Mut = 99 bp
Wt = 103 bp
Fam = Mut
Hex = Wt
MUT Sequence (junction in uppercase):
tctctttcccggttggtgttctagcttgcctgtcgctctaaagaatccgcccacctccgGAGAAAGCAGGagggagcaggaatggtggacacagatgactggtggcctttgctggcttctgcctgtcctttatagctaattc
This mutation is a 7358 bp deletion beginning at Chromosome 3 position 95,624,895 bp and ending after 95,632,252 bp (GRCm38/mm10). There is a 9 bp AGAAAGCAG insertion at the deletion site.
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52157 | TGC CTG TCG CTC TAA AGA ATC | Common | A | |||
| 52158 | CCT CCT ATG AGA GCC AAT GAG | Wild type Reverse | A | |||
| 52159 | CAG GCA GAA GCC AGC AAA G | Mutant Reverse | A | |||
| 52160 | Fluorophore-1 | ATT GGT GTG TCG TTA CAT CAT TGC | Quencher-1 | WT Probe | ||
| 52161 | Fluorophore-2 | AGA AAG CAG GAG GGA GCA GG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52157 | 0.40 uM |
| 52158 | 0.40 uM |
| 52159 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.