For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:67228511+67228621 111bp AAAGCTGAGAAAGGGACAGC TCCCTGGCCACATAAGGA
Mut = 116 bp
Wt = 111 bp
Fam = Mut
Hex = Wt
Sequence
MUT Sequence (junction in uppercase):
ggaagaagggtggggaatcttttttgcacacagtaagcacttagggaaagtatgatcttattctgtgtcagtATtgccgcaggctcttgctgtgcacatccttatgtggccagggaaggacagattaagtggtaaacagtgcattct
This mutation is a 5123 bp deletion beginning at Chromosome 7 position 67,223,456 bp and ending after 67,228,578 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51005 | TCC CTG GCC ACA TAA GGA | Common | A | |||
| 51006 | AAA GCT GAG AAA GGG ACA GC | Wild type Forward | A | |||
| 51007 | GGA AGA AGG GTG GGG AAT CT | Mutant Forward | A | |||
| 51008 | Fluorophore-1 | AGC TGA CAG GAG CCT CGA C | Quencher-1 | WT Probe | ||
| 52145 | Fluorophore-2 | TGC ACA CAG TAA GCA CTT AGG GA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51005 | 0.40 uM |
| 51006 | 0.40 uM |
| 51007 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.