For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:76268688-76268785 98bp TGAACAATAGCCCACCACAG GCGTTCTTAGTTGACATTTTGACTG
Mut = 94 bp
Wt = 98 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TATTTAAAATAAAAACATTTATTTAAAGACAAGATGTTTGAACAATAGCCCACCACAGCATCACagggtacattttgaatctgtcatctctgttttaggtaagattatctccagtcaaaatgtcaactaagaacgctacagatctagttgagtatgttgacaagtaagtctgtaagttaagtctatttcctgcatttaatgaatcagtggagattagaatggctgaaggaaacttttcaaatcatgtaagtagctctctgctctcagaaaacctgaacaaccttagacagacaaagttcactgtttctaaacacatggtgctaccttctctttaagtgacttcataaactcctacagatctgttggggaaataatacaacTGGGGCCAGAAGTGGCACATAACACAACAGATAAACAACTATAACTTCAAATTAAGCCAAGCAGATCCACCGACAC
This mutation is a 316 bp deletion beginning at Chromosome 13 position 76,268,444 bp and ending after 76,268,759 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51994 | TGA ACA ATA GCC CAC CAC AG | Common | A | |||
| 51995 | GCG TTC TTA GTT GAC ATT TTG ACT G | Wild type Reverse | A | |||
| 51996 | GGA TCT GCT TGG CTT AAT TTG | Mutant Reverse | A | |||
| 51997 | Fluorophore-1 | AGG GTA CAT TTT GAA TCT GTC ATC TC | Quencher-1 | WT Probe | ||
| 51998 | Fluorophore-2 | CCA GAA GTG GCA CAT AAC ACA A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51994 | 0.40 uM |
| 51995 | 0.40 uM |
| 51996 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.