For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:127707637-127707737 101bp AGCGCACTTACACACACACA AAGGTGCTGCATCAGGTTG
Mut = 100 bp
Wt = 101 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CCAGAGGTCTACAAAGCGTGGTCCGGAGTGGTGCTTTCCCTGAGCGGGAGCCCTCATCTATGCCCCGccccctgaagcttttgacactctagcaagcttggccccgggtcttcattgccagagtccctggccaggccttggtggcgccctgctgagtgccccaggtgtctgcaaaaccgcagctccaagttatatccgtttctgctttgccctggggtttgagggctctttctgcttctgtgccagtgttagcgaagctgtccctaccctagcacacctccctgacctccagtctgtggggctcatccttgggcctccctgatccagtctcctgacctcccacagggagaagcgctgggtgactgtgggagacacttcccttcgaatcttcaagtgggtgcctgtggtggatccccaggaggaggtgagcaagccccaacccccaacaggccttgcatctgtgcagcctcaagcaatttccctcccagccttggcctccaccttcagtcggcttggagactccagtgtggagcccaggcagatggtaacgattattagggggcgcgagcgcacttacacacacacacacacacacacacacacacacacacacactttctccaagttcaaggcctaactcaatctacacaacctgatgcagcacctttcgcttctctgagcctaggtttccttattcgtattgaagggctttgtaagagctccctagacaactagctctgatcttacctctctaacccccaggagaggcggcgggcaggaggcggggcagagagatcccgtggccgggagagacgtggtaggggcaccagtcccagagggggaggccccctcatcctactggatctcaatggtatgtagagattctggaatggagttgggtgggggggactgaaggaatcccctggggatctctggctaattaacgcgcggcttttgcttcatcagatgagaacagcaaccagagtttccattctgaaggttcattgcaaaagggtgctgagcccagccctggggggacgccccagcccagccgccctggatcaccaactggacccccagaagtgattactgaagatactcagcccccacaattgggtcaggagagaggtagggccctgtggctctcaggagccctctcatcaaagttgaacccaccatcctgtccttgtttcttatattatgtcctctcacccggtcccgcctccctcagggaatcttccctgaccctggcagagatcacctccagctgtgcctcaatcctccgGCTTCTTAGATCTGTAGGGAGCATATCACCAGCTGACTTTTTTTTTTTTTTTTTGCAGATTTATTTCTTTGCTTGCTTATTGTCTTTTTCTGTTATCA
This mutation is a 1218 bp deletion beginning at Chromosome 7 position 127,707,019 bp and ending after 127,708,236 bp (GRCm38/mm10). There is a 26 bp insertion (GGGCCAAGCTTGCTAGAGTGTCAAAA) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49916 | GGA GTG GTG CTT TCC CTG AG | Mutant Forward | A | |||
| 49918 | TGG TGA TAT GCT CCC TAC AGA | Mutant Reverse | A | |||
| 51664 | Fluorophore-1 | CGG GGC CAA GCT TGC TA | Quencher-1 | MUT Probe | ||
| 51946 | AGC GCA CTT ACA CAC ACA CA | Wild type Forward | A | |||
| 51947 | AAG GTG CTG CAT CAG GTT G | Wild type Reverse | A | |||
| 51948 | Fluorophore-2 | ACA CTT TCT CCA AGT TCA AGG CC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49916 | 0.40 uM |
| 49918 | 0.40 uM |
| 51946 | 0.40 uM |
| 51947 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.