For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:70229613-70229732 120bp GGCTGGGTAATACTGGGAAGA GCAGAGAGGAAGATGGGACA
Mut = 120 bp
Wt = 120 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TATTCAGAGACAGCATCTGTGGCATGGCCTTGCTTGTAGCTTGTGGCTGGGTAATACTGGGAAGAACCctggaaggaaggcccccagcagggacctcctgcctgggggacttgaggaaggatagttgtcacttgactccagcactgtcccatcttcctctctgcaggggttgatctgagcaacattgtgaagacaataccgaaagtatcactggatggccttcaggagcccacacatagtgtccttcaggtaggagcctccgtctccaccaccTTGGTGGAACAGACTGCAGGGGTGGGTGTCTCTTCCCTGTGTTCCATATGGCAGAAGT
This mutation is a 205 bp deletion beginning at Chromosome 8 position 70,229,504 bp and ending after 70,229,708 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49730 | GGC TGG GTA ATA CTG GGA AGA | Common | A | |||
| 49731 | GCA GAG AGG AAG ATG GGA CA | Wild type Reverse | A | |||
| 49732 | GGT CAC AAG CTG GAC AGA CC | Mutant Reverse | A | |||
| 49734 | Fluorophore-1 | CCT TGG TGG AAC AGA CTG CAG | Quencher-1 | MUT Probe | ||
| 51930 | Fluorophore-2 | AGC AGG GAC CTC CTG CCT G | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49730 | 0.40 uM |
| 49731 | 0.40 uM |
| 49732 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.