Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr12:74302199+74302291 93bp TCAGGTAGCCGAAGACATCA CAGCTGTTGAGTTAGTTGGAAAG
Mut = 88 bp
Wt = 93 bp
Fam = Mut
Hex = Wt
MUT Sequence (junction in uppercase):
gattcgttccttcggaaatgctttggctggtcactgtgcctgacggttgtttgtcattagtgtccttaacCAtggttgctgtctttccaactaactcaacagctgtgcctgctgtttctt
This mutation is a 5723 bp deletion beginning at Chromosome 12 position 74,296,535 bp and ending after 74,302,257 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51852 | CAG CTG TTG AGT TAG TTG GAA AG | Common | A | |||
| 51853 | TCA GGT AGC CGA AGA CAT CA | Wild type Forward | A | |||
| 51854 | ATG CTT TGG CTG GTC ACT G | Mutant Forward | A | |||
| 51855 | Fluorophore-1 | AGA CAG AGC GTT CTA TAG ATA TCA GCA | Quencher-1 | WT Probe | ||
| 51856 | Fluorophore-2 | TTG TTT GTC ATT AGT GTC CTT AAC CA | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51852 | 0.40 uM |
| 51853 | 0.40 uM |
| 51854 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.