For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:57487831-57487950 120bp CAGAGCGCAAGTTAGCTCCT CCTCCTTCTCAACCCCAGA
Mut = 105 bp
Wt = 120 bp
Fam = Mut
Hex = Wt
Sequence
MUT Sequence (junction in uppercase):
gaacagagcgcaagttagctcctcgatcaagaactaCCttccctaggtggatttgatttgcaattaagcattcttgtttttgttttgttttgtttctccgtgtaaccctggatgccct
This mutation is a 5368 bp deletion beginning at Chromosome 8 position 57,482,549 bp and ending after 57,487,916 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51839 | CAG AGC GCA AGT TAG CTC CT | Common | A | |||
| 51840 | CCT CCT TCT CAA CCC CAG A | Wild type Reverse | A | |||
| 51841 | GGG TTA CAC GGA GAA ACA AAA CA | Mutant Reverse | A | |||
| 51842 | Fluorophore-1 | CAG AGG AGG GGC GTC TCC | Quencher-1 | WT Probe | ||
| 51843 | Fluorophore-2 | ACC TTC CCT AGG TGG ATT TGA TTT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51839 | 0.40 uM |
| 51840 | 0.40 uM |
| 51841 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.