For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:104693186+104693341 156bp ATTTAAGCCGGGTGATGGT CTCTGTACACGAATAACGATGTTTC
Mut = 150 bp
Wt = 156 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GGCCATGATTTAAGCCGGGTGATGGTCCGTGgagagcttagcatcctatttggaaatttccacaatcaaagatcgagaggaagataaagccgggaaaacaactcagcagttattctaatttctgtgccatttagatatgaaacatcgttattcgtgtacagagaagaaaaacctacagagttctcaggatcaaaaaaactcaggagaaagaaaagtgtgcaagtacagcttcatagtaagagaacggaggcgagtctgaacctggcaagtgtcccttgtccccagcccccaaagcttctgGATGTTTTAGTTCAAGTGTTGAAATGTTCCTATTT
This mutation is a 269 bp deletion beginning at Chromosome 11 position 104,693,210 bp and ending after 104,693,478 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51834 | ATT TAA GCC GGG TGA TGG T | Common | A | |||
| 51835 | CTC TGT ACA CGA ATA ACG ATG TTT C | Wild type Reverse | A | |||
| 51836 | GGA ACA ATC AGA GGG TGG AC | Mutant Reverse | A | |||
| 51837 | Fluorophore-1 | CTT AGC ATC CTA TTT GGA AAT TTC CAC | Quencher-1 | WT Probe | ||
| 51838 | Fluorophore-2 | CGT GGA TGT TTT AGT TCA AGT GTT GA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51834 | 0.40 uM |
| 51835 | 0.40 uM |
| 51836 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.