For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:6062321+6062431 111bp TGTGACAGCTGAGGAGATGG CCAGTTCAGCCAGGGAGTTC
Mut = 120 bp
Wt = 111 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AAAGAAGTACTGGAGACACGAAAGTTACCGAGAAGTTTCGGAAATGTGCGGAAAGGAGGCCACGCCCGCCAACCACCCCCACACATAAAGGCGGAAATAAccaaagaagcgccggaagtggcggagctgatacgggacaggcggcaccagtttccatggagcccgctgggctctgcggcttctgcccggccggggaagcgctgcctgcgcgctacacctgcccgcgctgcaatgctccctactgctcgctgcgctgctaccgggcgcacggcgcctgcgccgaagacttttaccgcgaccaagtgctgcgagagctccgtggccgaagcgcttcgcccagccgtctggcgggcgcgttacgccggctgcgcgaacaacgcgaggccgaggatgagcccgaggaagcaggcctcgggcccggggcgcggccgggcggcctttctggactttgggaacgtttaacgccggctgagaaggcggcgttcgagcggctgctgagccgtggcgaagccggacgccttctgcctccgtggcggccctggtggtggggccgcggcaccggcccacgtttgctggaggagctggatcatgccgcgaacagagatcttgcggagccggagcccgcccctgcgaggaccgcgctgcaatctggggatgatgccgctgccgcagagccatttgctgaagactcctgtgccgccagaccgctagcattgcctgctcgcatcccagcactggccagtctgagccgcagcccggcatcgccgctggtgcgcttccagctgcccaacgtgctgttcgcctacgctcatactctcgccctgtatcatggaggggacgacgacgcgctactctctgacttctgtgccaccctgctcgatgtttctggggccctgggagcccagcaagtctttggctctacagaggaagccctgcaggccgcagcccacgtactggaagcgggcgagcacccacctgggcccctgggtacgcggggtgctatgcaagaagttgcccgaatcctgctgggcgagggtccagtcaatcagaaaggctacactctgacagcactggggcacctagctcagaccctgggacgagcccggaagcaggctgtgattggtggagagcgagatcgactttaccgggctcggaagaagtgccagttcctgctggcttggaccaacgaaaacgaggctgccctcacacccctggcgctagactgtgccagagcccaccgagcccatgctgtgacagctgaggagatggcaacgcttactggagagttagaacggctttggggaggcccagtgccacccactccaaggactctcattgaggaactccctggctgaactgggtatccatgtcattaataaagatgtgtctggtctgcccgaatgtcagcagtgccttttccgtaaagatagtgccctgtcctaggcttctcttgaagttactgtgtagttgaggatgaccctggaactttgatctgtcacccacctggacagtgagaggttacaggggttaaccaccttgctaatgtacacagtgctgaatagccgaggcgtcctgtgtgctacacaagcactctataactgaactacatcacatcccccaggcctgaggtgcccagttgtctctcctcgtcagacttttggacCCACAAACCACTTCTAAGCTTTCCTTAGTCAACTAGTCACCCCCAAGCCTCAAGTCACTGGCCCCAGGATAGAAGAAAAACACAGGAAAGGTTGAAAACATTTATTCAACAGGGAAAAATACTTTCCTTCTGGAAGCAGTGGCTTCCTCTTGCTTTCAACCT
This mutation is a 1563 bp deletion beginning at Chromosome 19 position 6,061,172 bp and ending after 6,062,734 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51563 | TGT GAC AGC TGA GGA GAT GG | Wild type Forward | A | |||
| 51564 | CCA GTT CAG CCA GGG AGT TC | Wild type Reverse | A | |||
| 51565 | AAC CAC CCC CAC ACA TAA AG | Mutant Forward | A | |||
| 51566 | CTT TCC TGT GTT TTT CTT CTA TCC | Mutant Reverse | A | |||
| 51567 | Fluorophore-1 | CTT TGG GGA GGC CCA GT | Quencher-1 | WT Probe | ||
| 51568 | Fluorophore-2 | AAC CAC AAA CCA CTT CTA AGC TTT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51563 | 0.40 uM |
| 51564 | 0.40 uM |
| 51565 | 0.40 uM |
| 51566 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.