For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:45408742+45408832 91bp TCACTAGGCCCAGGAGACAC AACTCAAGACCCCAGCGACT
Mut = 99 bp
Wt = 91 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GACCTGTCCTGCCTCACGCTCCTGAGGGTGGAATGACAGGCTCATGTCACTAGGCCCAGGAGACACCACCTTTCCTGCCCctaggtctgaagaacagacattcagctatccaaaggcagtcgctggggtcttgagttgtgtagagcagtgaagtcacccctcaggaacactgacactgctattttcacattgaaacagtgactagaggttttggcctggctccctgacccctttctgtcccttctgcagttcctcgcccgactgaatggctccagtcccatgccaggagcccctccccgacagcccttcaacgatccattctttgtggtggagaccctgtgtatctgctggttctcctttgagctgctggtgcgtctggtggcctgccctagcaaagctgtgttcttcaagaatgtgatgaacctaattgacttcgtggccatcctgccttacttcgtggccctgggcacggagttagcccggcagcggggtgtgggccagccggctatgtccctggccatcctaagggtcatccgattggtgcgtgtcttccgcatcttcaagctctccaggcattcgaagggtctacagatcttgggtcagacactgcgggcttccatgcgtgagctaggtctcctcatcttcttcctcttcattggcgtggtcctcttttccagcgcagtctactttgctgaagtggaccgggtggacacccatttcaccagcatcccggagtccttttggtgggcagtggtcaccatgaccacggttggctatggggacatggcacccgtcaccgtgggtggcaagatcgtgggctctctgtgtgccattgcaggtgtgctcaccatctctctgcctgtgcctgtcattgtctctaactttagctacttttaccaccgggagacagagggcgaagaggcagggatgtacagccatgtggacacacagccctgcggtaccctggagggcaaggctaatggggggctggtggactctgaggtgcctgaactcctcccaccactctggccccctgcagggaaacacatggtgactgaggtgtgagggtcaactggggtctccagggagcagtggggtgggagggaggagggaaggcagggtcaggtgctgggttaaggactaagatggtaacaaaagggtacagattcttaatctgaaggcatgtcacatggtggctcctagggggaccttatgtgacaggaattgccaggatttgggttgtgtccagggctccccccATTGATTGCGCAATGTGGTAGAGCTGTGCAAATGTCCAGGGGCTCTATGGGTAGCACTGTAAGAGACTTGGCC
This mutation is a 1179 bp deletion beginning at Chromosome 7 position 45,408,776 bp and ending after 45,409,954 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51520 | TCA CTA GGC CCA GGA GAC AC | Common | A | |||
| 51521 | AAC TCA AGA CCC CAG CGA CT | Wild type Reverse | A | |||
| 51522 | CTC TTA CAG TGC TAC CCA TAG AGC | Mutant Reverse | A | |||
| 51523 | Fluorophore-1 | AGG TCT GAA GAA CAG ACA TTC AGC | Quencher-1 | WT Probe | ||
| 51524 | Fluorophore-2 | CCA TTG ATT GCG CAA TGT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51520 | 0.40 uM |
| 51521 | 0.40 uM |
| 51522 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.