For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:138151016+138151144 129bp TCCACATGGGGTTACAGTGA AATGCCTGTGCTCTGTCTCC
Mut = 131 bp
Wt = 129 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TAAATAGGTAAATACCCCTACTGCTTTGTCATATCTCACAATATTTGGAAGTAGGGCGCTCATTTTGGTTTGTTTATGTTGTTACGTCGATGCTAGttgagcctggggccttgagtgctgtcatcacgctatccccagcacaagtgaattttttggttgttcttctttttcgtatttggaataggtttttgccaacccagaagactgcgctggctttggcaagggagagaatgccaagaagtttgttcgcactgacgagaaggtggaacgcgtgcgcaggtaaaccagtgtctctggaaattcctcactcaagaatcatgctcatggagtccagccaggatctcaggatcttagagactgggggaggggggatgatccacttaatctctgtagtaggtgtaacaactccagcaaattagatacatagagttctccacatggggttacagtgactcttgtcagcaattttgttgcagttctagactttattggggtcagtggctgtactctgtttatagatacataaagataatagtatgcaggagacagagcacaggcattagATTCTTGCAGCTATGTTATTTTTCTCTCAAATTCAGATGGTCAGTTCACATAAAACATCAAAGATC
This mutation is a 467 bp deletion beginning at Chromosome 6 position 138,150,680 bp and ending after 138,151,146 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49668 | CCC CTA CTG CTT TGT CAT ATC T | Mutant Forward | A | |||
| 51476 | TCC ACA TGG GGT TAC AGT GA | Wild type Forward | A | |||
| 51477 | AAT GCC TGT GCT CTG TCT CC | Wild type Reverse | A | |||
| 51478 | GTG AAC TGA CCA TCT GAA TTT G | Mutant Reverse | A | |||
| 51479 | Fluorophore-1 | ATT GGG GTC AGT GGC TGT ACT CT | Quencher-1 | WT Probe | ||
| 51480 | Fluorophore-2 | ATT TGG AAG TAG GGC GCT CAT TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49668 | 0.40 uM |
| 51476 | 0.40 uM |
| 51477 | 0.40 uM |
| 51478 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.