For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:29993423-29993532 110bp AACCAGGACTGTAAGGAATGTGA TCAAACTCCAGCATAACACTTTGC
Mut = 102 bp
Wt = 110 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CTCCCCCTTCCCCTCCCCTTCCCCTCCCCCTCCCCTTCCCCCTCCCCCCCCTCTCTCTTTCTAAGCAAACTATGGGCTGTGTTTTGTGTAACTCCATAAGAcggctggttatggtgatgaggacttttggatcccaccttgctagctaaagatccttgcactgtttctacagaagaacggcagcaccgctgtgaggactgtgaccagctctttgaatccaaggcagagctagccgatcaccagaagttcccatgcagcacacctcactcggccttctccatggtggaggaggacttgcaacaaaacctggagagtgagagcgatctccgagagatccatggcaaccaggactgtaaggaatgtgaccgagttttccccgatctgcaaaggttagagaagacatggtgaacgtgggtgtgtgctctgcagcaaagtgttatgctggagtttgacaagtttgctcgggGGAAGACTAGAGCTTCAAAACAACTGGCCAGATGTGCTGGTGGCATGCTTGGGAATCATTGCTTCCTTAAAAAGCCTTGTCCTTAAGATACTTACAGTGGACCTGGATCATTTTTGTCAATCAGAAAATATTCCATCCCTTCC
This mutation is a 365 bp deletion beginning at Chromosome 3 position 29,993,409 bp and ending after 29,993,773 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49716 | AAC CAG GAC TGT AAG GAA TGT GA | Wild type Forward | A | |||
| 49717 | Fluorophore-1 | ACA TGG TGA ACG TGG GTG TG | Quencher-1 | WT Probe | ||
| 51387 | TCA AAC TCC AGC ATA ACA CTT TGC | Wild type Reverse | A | |||
| 51388 | AAG CAA ACT ATG GGC TGT GT | Mutant Forward | A | |||
| 51389 | AGC AAT GAT TCC CAA GCA | Mutant Reverse | A | |||
| 51390 | Fluorophore-2 | AAC AAC TGG CCA GAT GTG CTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49716 | 0.40 uM |
| 51387 | 0.40 uM |
| 51388 | 0.40 uM |
| 51389 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.