For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:50140636+50140749 114bp GGGGAAAAGGATTGTAGATTTACTG CCTCCTGCATGTTTCAGCTC
Mut = 103 bp
Wt = 114 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CTGTGGGAAGAGCACTGTGCTTCCGTTTCCACTCTCCGTGCACTGCTCAGACAGATGCTGGGGAGTGGGGGAGGCCAGCTGAAGACAGTAGCTGTTTGCCTGCCCTGCAgggactctgtcaacaacgggacaaagaaatctgataaatttacctgtttacagccgccttgtagattgtctctagaagaacaggagtactcttggtaggggagggaggactctcactgtaatagaaagtgtaaacaggagaggctcatccttgccttgggaggagggggtcacttgaatagagagagagcactggggacccagccctctgcttgagtctgagctctgatttcatccactctcactgaactaggttcttcccgaaaagagatcaccaaacactgggaatggctggaaaacaacttgcttcagacactgtccatcttcgacaacgaggaggacatcactaccttcgtcaagggcaagatacacgtaaggcccatgtcccaccgacaaccaacccagctccctttgtgaagtgctagcggccacacacagttgttgctccatatctgtgggatacaatgaattccatggattcaaccaactgtgtgtcgaaaatatttggggaaaaggattgtagatttactgaacactgtcagtctttcctaggcaatacagaagagcagagcatccctgcTGTGGTGCGTGTTGTAAGATGAGCTGAAACATGCAGGAGGGGGGACAGGCAAACTATCAACATACATAGATTTATATAT
This mutation is a 579 bp deletion beginning at Chromosome 11 position 50,140,131 bp and ending after 50,140,709 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51362 | CCT CCT GCA TGT TTC AGC TC | Common | A | |||
| 51363 | GGG GAA AAG GAT TGT AGA TTT ACT G | Wild type Forward | A | |||
| 51364 | TCA GAC AGA TGC TGG GGA GT | Mutant Forward | A | |||
| 51365 | Fluorophore-1 | AAT ACA GAA GAG CAG AGC ATC CC | Quencher-1 | WT Probe | ||
| 51366 | Fluorophore-2 | AGG CCA GCT GAA GAC AGT AGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51362 | 0.40 uM |
| 51363 | 0.40 uM |
| 51364 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.