For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:105805212+105805336 125bp TCTGCTGGTTTCTTGCATTG GCTCTGATACTTCTCACATCCAGT
Mutant= 110 bp
Wild Type = 125 bp
Sequence
Wt Sequence (deletions in lower case and insertions with carrots ^ctggttttgggagt^ (ctggttttgggagt insertion):
CTAACATTTTTATAATTCCAGTTCTTAGATAACAAAAAAAAAAAAACCAGAAAGACCCTCTGCATAAATTAACAAATAACTGAGAACTTTGTTGTTCTGTCATTTGAATTGGTTTCCCTGC^ctggttttgggagt^tttactaacaaccattgtttgttaacagaatctcccacaatctgtaattgaaaatgttggagggaagatttttacatttggatcttacagactaggagtccacacgaaaggtaggtaatactttgcttattttgagctagtagaatttgcatttctttaagattttgagttattaatgactcataaacgagctttggttattgtggacgtgaatccttaagaagctgtctgtagctgccatctgtaatgcagtatagtaagtaatacgctcagttaaccagtggagtaaggtgtgttttctgtatctaagcactctgctggtttcttgcattggaaagtgtgggcacagagcaaattccactgtggtctatggACAATTCTCCATAGATTCCTTCTTTCTTTCTGAAGAGTATCACTGGATGTGAGAAGTATCAGAGCTCTAAGAAAGTATCGTCATTTTCTTGTCCTCATTTTTTTTATTGTAGATAGCTTATAAAATACATCTTAGCAAATACAGAATCAGTATGCCTGTAGCTACTGATCACATTGAATATTTACTTTAAATTTTT
This is a 373 bp deletion beginning at Chromosome 12 position 105,804,899 bp and ending after 105,805,271 bp (GRCm38/mm10). There is a 15 bp insertion (ACTCCCAAAACCAG) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47860 | GTT GTT CTG TCA TTT GAA TTG G | Mutant Forward | A | |||
| 47861 | GCT CTG ATA CTT CTC ACA TCC AGT | Common | A | |||
| 47862 | TCT GCT GGT TTC TTG CAT TG | Wild type Forward | A | |||
| 47864 | Fluorophore-1 | TGG GCA CAG AGC AAA TTC | Quencher-1 | WT Probe | ||
| 51332 | Fluorophore-2 | CTG CCT GGT TTT GGG AGT AC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47860 | 0.40 uM |
| 47861 | 0.40 uM |
| 47862 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.