For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:75919296-75919442 147bp CAACAGAAACGGCAGTGCT GGACAGAAGGACGAGAGCTG
Mut = 153 bp
Wt = 147 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AACAGAAACGGCAGTGCTATTTAAGTACGATGAATTGACTTGATCAGccccaaggacaagcaaccctaaggagccttaggctcacactgggctgggcaagctgtgtcctatcttcccagtccttaccagctctcgtccttctgtccaggcaaagtagaagctaaacaagtgctggccagtgcaccaacggacaacaacctctgccacttcagggtgagtgggacctagagggccttgtctttctgaagcatttatcaggggcaggtatggcagacggtttgagatggtttggtctgtccaggggaactaggcgtcagaggccaggaagaaagttctggaaggactagcatagatgcagtgtgtgtcttatgtagggtgggtgtggacactcattaggagggaaggttctagaaggcacaacttaagagtttgaggagcagggcctgttgggtttgtcgtaggcgttggagagtacagcaagtacagacattggtgacccACGGGATACGGAATGGTCGATGGCACGCAGGTCAGCCTGTGTAGGATGCTGCCTCACACAGCCTCATTTCTGGCCCTTGTGTCTCTTTAGGCTCTGGGTTGCCAGACTACTCACTCCAACCATGAGGTGCTGCAAAACTGCCCACTTGTCATCTTTGCCACCAAACCCCAAGTCCTGCCAACTGTCCTGGCGGAAGTGGCCCC
This mutation is a 452 bp deletion beginning at Chromosome 15 position 75,918,943 bp and ending after 75,919,394 bp (GRCm38/mm10). There is a 2 bp insertion (AA) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51315 | CAA CAG AAA CGG CAG TGC T | Common | A | |||
| 51316 | GGA CAG AAG GAC GAG AGC TG | Wild type Reverse | A | |||
| 51317 | GGC AAC CCA GAG CCT AAA GA | Mutant Reverse | A | |||
| 51318 | Fluorophore-1 | CTG GGC TGG GCA AGC TG | Quencher-1 | WT Probe | ||
| 51319 | Fluorophore-2 | AAA CGG GAT ACG GAA TGG TCG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51315 | 0.40 uM |
| 51316 | 0.40 uM |
| 51317 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.