For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:5959180+5959305 126bp CTGTTTCTAAGGTTAAGAGGGAATG TCCTGCACACTAGGAAATATAACACA
Mut = 119 bp
Wt = 126 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TACTGTTTCTAAGGTTAAGAGGGAATGAATAAAACCAAGAGAACCTCGGAGGTCACTTTCCActgtgttggggacagtgtgaccgaaagaaggttgtaaatatgtgttatatttcctagtgtgcaggaattcatgacctttacaagtcaactgattgtggaacgctcggggaaaggcagcagagcttctgtcaaagaacaaggtaagaggactcccgcccctctgagtgctggcctggctgtcacacatgctgcccgtgccgtgtgactgctcccaggcctgtgctcctctgctaccgcatgtcctcgccTTGCTTCTCCTATCCATAAAGAGCACTAAACCAAATGTTGAAGTCCACACTTGCTGCACCCTGATGTGCAACTGCACTTAGACAGCTTACACTCACTGCTCGTTAGACTCTGGCTCTCCACCTGCCCCAGCCTGGCA
This mutation is a 248 bp deletion beginning at Chromosome 11 position 5,959,240 bp and ending after 5,959,487 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51301 | CTG TTT CTA AGG TTA AGA GGG AAT G | Common | A | |||
| 51302 | TCC TGC ACA CTA GGA AAT ATA ACA CA | Wild type Reverse | A | |||
| 51303 | GTG CAG CAA GTG TGG ACT TC | Mutant Reverse | A | |||
| 51304 | Fluorophore-1 | ACA GTG TGA CCG AAA GAA GGT TG | Quencher-1 | WT Probe | ||
| 51305 | Fluorophore-2 | CCA TTG CTT CTC CTA TCC ATA AAG A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51301 | 0.40 uM |
| 51302 | 0.40 uM |
| 51303 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.