For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:65647244+65647363 120bp CAAGGGTTGTCTATTAAGAAGTGC TCCCCTCTTACCTAGTGTCTCTG
Mut = 119 bp
Wt = 120 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
ACCAAGGGTTGTCTATTAAGAAGTGCTACACTGTATATATAATATTGCATAAATATACAgtcagtggtgggagagggatacgtccatgagtgtagtattcagagacactaggtaagaggggaagggctgctggaggggacatcaagagagggggagcatgcggagaggtgaagtaggacccgctgagccaatagctccgtgggctgagtccttaacggtatgctaatgactttcaggtgaagcaaccgaattttataaaagagagattgcagctttttgaaacattgaagacagatcatcaactgttacctgctactcaggaaaagaagaacacaaacaacgtgatttcagtgagggtggctggtgggaagacagtgcaaggagaaaggtggaaaacaacaccttatcaagtggccgctggaattaggtaaggcccgcccccttgccgacgccccgcccccgccagacgcatgcgcacaagcatacatacctgcccacagactccttgttcgtctattttcctccctacctGTTTGTTTGAAGCACATATACTCCAGCATTAAGTAATTGTGCCAGAGCCCGTTGAAAGGTTTTATTGACACTAAAATAT
This mutation is a 472 bp deletion beginning at Chromosome 7 position 65,647,301 bp and ending after 65,647,772 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51247 | CAA GGG TTG TCT ATT AAG AAG TGC | Common | A | |||
| 51248 | TCC CCT CTT ACC TAG TGT CTC TG | Wild type Reverse | A | |||
| 51249 | AAA CCT TTC AAC GGG CTC TG | Mutant Reverse | A | |||
| 51250 | Fluorophore-1 | AGT GGT GGG AGA GGG ATA CGT | Quencher-1 | WT Probe | ||
| 51251 | Fluorophore-2 | CAG TTT GTT TGA AGC ACA TAT ACT CCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51247 | 0.40 uM |
| 51248 | 0.40 uM |
| 51249 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.