For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:33410973-33411090 118bp GAGTCCCCCGAAAGAACAG AGTCAGGCGCATCAGACACT
Mut = 119 bp
Wt = 118 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GCAGACCGTAGTGCTAGCTGCAGAGTTGCAGTGAGCTATTTATGCTGCCTGCTCTTACTGAGGAGCCCTGGCGAATTACGGGTGCTCTTTGTCTCTGCAGATTACGTTTCGTGTCGGGagaaatggacaacagcagtttcattcagtttgatgtgcctgagcacagcagcacggttctgagccaactaaatgagctccgcctgcaagggaagctatgtgacatcatcgtccacattcagggtcagcccttccgagcccacaaagccgtcctcgcagccagctccccgtatttccgggaccattcagcactgagcactatgagtggcttgtcgatctctgtgattaagaaccccagcgtgtttgagcagttgctctccttctgttacactggaaggatgtccttgcagctgaaggatgttgtcagttttctgaccgcagccagctttcttcagatgcagtgtgtcattgacaagtgcacacagatcctagagagcatccactcgaagatcagcgtgggagacgttgactctgttaccattggtgctgaagagaatcctgagagccgaaatggggtgaaagatggcagcttcttcaccaatcctgttgaaatctcccctccgtactgccctcaggtacggcagcctccagtcagcagtgatcttcggatggagacaacccccaacaaagcccttcggagccgcttgcaggaagaggggcactcagatcgggggagcagtgggagcgtgtctgagtatgagattcagatagaaggggaccacgagcaaggggacttgttggtgagagagagccagatcactgaggtgaaagtgaagatggagaagtctgaccggcccagctgctccgacagctcttccctgggtgatgacggctaccacacggagatggttgatggggaacaagttgtggccgtgaatgtgggcgcctatggctctgtgctccagcatgcatacccctactcccagacggcttcacagccttccagtgtgccagaagcttttggaggtcagaccaattccagtccatccaggtccatgctgagctgcttccgaggccgtggggcccgccagaagcgagctctgtctgttcacctgcacagtgacctgcagggtgtggtgcaggggtctgacagtgaagccatgatgaacaatcccggttatgagagcagtccccgggagaggagcgccagggggtattggtacccatacaacgagaggttgatctgtatttactgtgggaagtcctttaaccagaagggaagcctcgacaggcacatgcggctgcatatggggatcaccccctttgtgtgcaagttctgtgggaagaagtacacgcgcaaggaccagctggagtatcacatccggggccacactgatgacaaaccattccgatgcgaggtctgtgggaagtgctttccattccagggtaccctcaaccagcacctgcggaaaaaccacccgggggtcaccgaaggcaggggtcgcatggagtcccccgaaagaacagacatgtatgtggaacagaaactcgaaagtgatgcatcagcctcagagatggcactagattcccGCCTGGAAATGCACACAGTGTCTGATGCGCCTGACTAAGGAGCACCTGCACAGAGCACAGCAATCAGCGCGTCCTTGTGATCTGCTTGGTTGTAATCTTTGCTTTTCCCCACCACCTGGACATCTCTCGGTTTTTTTGCTAGTTTCTCTGAAGGTTCTGGGTGGGGACTTCTTGTGTTTACCCTCCC
This mutation is a 1469 bp deletion beginning at Chromosome 2 position 33,411,009 bp and ending after 33,412,477 bp (GRCm38/mm10). There is a 61 bp inverted insertion (GGGAATCTAGTGCCATCTCTGAGGCTGATGCATCACTTTCGAGTTTCTGTTCCACATACAT) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51214 | AGT CAG GCG CAT CAG ACA CT | Common | A | |||
| 51215 | GAG TCC CCC GAA AGA ACA G | Wild type Forward | A | |||
| 51216 | GCA GAT TAC GTT TCG TGT CG | Mutant Forward | A | |||
| 51217 | Fluorophore-1 | AAC AGA AAC TCG AAA GTG ATG CA | Quencher-1 | WT Probe | ||
| 51218 | Fluorophore-2 | CTG TTC CAC ATA CAT GCC TGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51214 | 0.40 uM |
| 51215 | 0.40 uM |
| 51216 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.