Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr5:117385436-117385539 104bp TGACACTTCCAGCCACTAGC ATATCGATCCCTCGGTCGTC
Mut = 97 bp
Wt = 104 bp
Fam = Mut
Hex = Wt
Wt Sequence (deletions in lower case):
AATGGCTGGCTGACACTTCCAGCCACTAGCTTGTAGCTGGCAcagggtgtgactgtcacagcatcctctcttcctcctgtagctgaatgcttctgacgaccgagggatcgatattgttcgggggccaatcctcagctttgccagcacaaggacaatcttcaagtaagaattacctgtaggatttctctccctacaggtcttagtgcgggttaGGAGGGACACAGCCTGGCTGTTCGGTCCCCCTTGGCTGGTATAAAGGGAAGAAGGGAACACCTGGACAGAAGCAG
This mutation is a 170 bp deletion beginning at Chromosome 5 position 117,385,338 bp and ending after 117,385,507 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51198 | TGA CAC TTC CAG CCA CTA GC | Common | A | |||
| 51199 | ATA TCG ATC CCT CGG TCG TC | Wild type Reverse | A | |||
| 51200 | CCA GGT GTT CCC TTC TTC C | Mutant Reverse | A | |||
| 51201 | Fluorophore-1 | CTG TCA CAG CAT CCT CTC TTC CT | Quencher-1 | WT Probe | ||
| 51202 | Fluorophore-2 | AGG AGG GAC ACA GCC TGG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51198 | 0.40 uM |
| 51199 | 0.40 uM |
| 51200 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.