For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:6619969-6620077 109bp AAAAGACCCCCATCAACCAG GGAAAGCCTATATCCTTGTTTG
Mut = 111 bp
Wt = 109 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AGCATCAGCTCAGTTGCTAGCTGATATCGGTGGCGTAACATCTTTGAGGGGCATCTAGAAAGATGAGAAAACATTTTCCTAGCAGTTCTTCCTGTCAgccccagccttttgcccagaactcaattccatctggtcctctgaaatatgttcaccttctgccttctcagcctgcctacgttcaggcttgtcaccaggccaaccctctttctgctttctgtcctatctcttttccccctctgaagaatacttcattctatcctaccttaatgatttccatgccctgctcttcctgccttactaaactttccttgaagcaccatattcccttcgaacctcccgcccattttccctctaccccagctacccttccttctaataaaagacccccatcaaccagttccgtagtctttcaccctgatcagaaaactagccactctcaggttgaTAGGGTAAGTCTAAAATCTCAAACAAGGATATAGGCTTTCCTGTAAATGGATAATTTCAGAAATGCACTTAGTAAGAGTTGCTAGAAACCCTGTGCTGTGAACCCAGAAAGAGCAGT
This mutation is a 348 bp deletion beginning at Chromosome 3 position 6,620,010 bp and ending after 6,620,357 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51085 | GGA AAG CCT ATA TCC TTG TTT G | Common | A | |||
| 51086 | AAA AGA CCC CCA TCA ACC AG | Wild type Forward | A | |||
| 51087 | CGG TGG CGT AAC ATC TTT G | Mutant Forward | A | |||
| 51088 | Fluorophore-1 | ACC CTG ATC AGA AAA CTA GCC AC | Quencher-1 | WT Probe | ||
| 51089 | Fluorophore-2 | CCT AGC AGT TCT TCC TGT CAT AGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51085 | 0.40 uM |
| 51086 | 0.40 uM |
| 51087 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.