For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:43581792-43581904 113bp AGTGAGCATCAGTCCCACCA GAAAATACCCAACCGGAGTC
Mut = 117 bp
Wt = 113 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TCACCTCGCTGCCTCTAGGTATCAAAGCTTGAAAGAGAGAAGACTCAAGAAGCAAAGAGGATTCGTgagttggagcagcgcaaacacacggtcctggtgaccgagcttaaagccaagctccacgaggagaagatgaaggagctgcaggccgtgagggagaatctcatcaaacagcatgagcaggaaatgtcaaggacagtgaaggtgcgggatggggagattcagagactcaagtccgcgctgtgtgctctccgggatggcagcagcgacaaagtaaggacagcactcaccattgaggcccgggaggaggcccggaaacagttcgatgcagagcgcctgaagctcctgcaggaaattacagacttgaaaactgccaagaagcaggtggatgaggctctaagcaatatgatccaagcggataaaatcaaagctggggaccttaggagtgagcatcagtcccaccaggaagccatctcgaagatcaagtgggaatccgaacgggatatacggAGGCTGGTTAGTACTAATAAACCGGGGGACTCCGGTTGGGTATTTTCTTGTCGGTTACCATAAACA
This mutation is a 444 bp deletion beginning at Chromosome 18 position 43,581,839 bp and ending after 43,582,282 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51015 | GAA AAT ACC CAA CCG GAG TC | Common | A | |||
| 51016 | AGT GAG CAT CAG TCC CAC CA | Wild type Forward | A | |||
| 51017 | CTT TCA CCT CGC TGC CTC T | Mutant Forward | A | |||
| 51018 | Fluorophore-1 | CCA TCT CGA AGA TCA AGT GGG | Quencher-1 | WT Probe | ||
| 51019 | Fluorophore-2 | AAG CAA AGA GGA TTC GTT AGG CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51015 | 0.40 uM |
| 51016 | 0.40 uM |
| 51017 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.