For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:15719906+15720024 119bp AACATCATGGGGATTTCTTCA CTGTCCTCAGGCTGCACAC
Mutant= 100 bp
Wild Type = 119 bp
Sequence
Wt Sequence (deletions in lower case):
TGTCAGGGATCAGAACTCAGGTCCTTAAGCTGAGGGTCAAATGCTTTATCCAGCAAGGCAACTCTCTAGCCTGATACTTCCTAATATTTAAACATTCACAAGTTGTAGCCACACATCAGTTTTACCAGcagtggtgcaggaccatatttttttttctgttttatagatatggacgtgatgaggcccttaataaacgagcagaatttcgatgggtcgtccgacgaggagcaggaacagacgcttgtgcccatacagaagcactaccagctcgatgggcagcacgggatttcgtgagtgtcacggtcacgggtccttagctctgttaccgcagcctgcatttctcagtctcccataggtctgagtgttttatgactaagaagattaaggagtcagactcctcaacacttatgtctatgagggagggacattaggctgactgaacatcatggggatttcttcagtagtgatagataccaaatgctgtgtccctcagAGGAAGATCTCAGAAGAGGGAGGGAGCTCGAGGGAGTGGGGAATGGGTGTGCAGCCTGAGGACAGGCTACAGGTGGAATGTTAAAAGCCTCT
A 365 bp deletion beginning at Chromosome 9 position 15,719,595 bp and ending after 15,719,959 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49682 | AAC ATC ATG GGG ATT TCT TCA | Wild type Forward | A | |||
| 49683 | CTG TCC TCA GGC TGC ACA C | Common | A | |||
| 49685 | Fluorophore-1 | TAG ATA CCA AAT GCT GTG TCC CT | Quencher-1 | WT Probe | ||
| 51000 | ATC CAG CAA GGC AAC TCT CT | Mutant Forward | A | |||
| 51001 | Fluorophore-2 | CAT TCA CAA GTT GTA GCC ACA CAT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49682 | 0.40 uM |
| 49683 | 0.40 uM |
| 51000 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.