For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:35825399-35825526 128bp GAAGACAGCCACCTCCCAAG CAAGTCACCCTCAGACTCCAG
Mut = 134 bp
Wt = 128 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GGCTGGGCGAGAGGGCGGAGCGGTTGGGACGCGAGAGAGGAGGGGACTTGGTGTGAGAGGCTCAGTGGGGACAGTTCCGCGCGAGAGACAAAGAGCGCCCAGAGAGCGCAGCGAGCATCGCTGCTACCCAGCCCGGCAACCTCGCAGATTCGAGGACAGGGTGCGCAGCGGAGCAGCCACAGCTGCTAGGGACCCAAGAGGCTACGCAGGATGCGGACGCCGGTggtgatgacgctgggcatggtgctcacgccctgcgggttgctgcttaatcttgtcagtacactggccccgggctggcggctggtgaagggctttctggaccagccagtggacgtggtgctgtaccaggggctgtgggacatatgtcgcgagcagagcagtcgcgaacgcgagtgcggccagcccgacgagtggaactacttccagacccagcctgtgcaggtggcccggggactcatgatcacgtcactggccactaccgccctagggctgctgctggcttccctcggtgtgcgctgttggcaagatgagccccactacgggctagcgggcctctctggcgtggtgtttttcgtcgctggcctcttcagcctcatcccggtctcctggtataaccacttcttgtcagatcccgacgtcctggccgccccgagctcgccggtcacggtgcaggtcagctacagcctggtgctgggctacctaggcagctgcctgctgcttctgggcggcttctctctggcgctcagctttgcgccctggtgtgaagagcgttgtcgccgctgtcgcaaggcgcccccagcaggcccgcgccgcagcagcatcagcaccgtctacgtggactggccggaaccagcgctcacacctgccatcaagtactacagcgacggacagcatcggcctcctcccaccgcagagcacagggacaccagcaagctcaaggttggattcccgatgccacgaccgccacccaagtcctacaccaacccgatggatgtgcttgagggagaagaaaagaagacagccacctcccaaggtggttcctcctctcgcagcactcggccctgccaaaattcgctgccctgtgactccgaCCTGTAGACAGGGTTCACCTGAGCTCTGCCTGGAGTCTGAGGGTGACTTGAACTTCTGCCAGTACATCTGCAACTAGAACCCTGGTCGCCTTCCTCTAACTGGAGGGCAAGCCTTCCTTTTCTAGGGCCAAACTCCTCTCCAAATACTAGGTTGGGTTCATTTATCTTTTAAGGAGTTTTACTTTTCTCTCCAGAG
This mutation is a 860 bp deletion beginning at Chromosome 8 position 35,825,454 bp and ending after 35,826,313 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49325 | CAA GTC ACC CTC AGA CTC CAG | Common | A | |||
| 49326 | GAA GAC AGC CAC CTC CCA AG | Wild type Forward | A | |||
| 49327 | CTC GCA GAT TCG AGG ACA G | Mutant Forward | A | |||
| 49328 | Fluorophore-1 | CTC GCA GCA CTC GGC C | Quencher-1 | WT Probe | ||
| 50972 | Fluorophore-2 | AGG CTA CGC AGG ATG CGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49325 | 0.40 uM |
| 49326 | 0.40 uM |
| 49327 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.