For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:79834117-79834216 100bp CAACACCATCAGGGATTTGG GAATGCATCCTCTAATACTCACTG
Mut = 91 bp
Wt = 100 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CTAGTGACAACATGCAACACCATCAGGGATTTGGCCCTGGGAACCCTCAAGagcgtaaggcaatggttgtgagaatcttagaaggaaagccagtgagtattagaggatgcattctagagttgtgttgaggcagaagttaaattcaggaaaaatggtaatttaactaagaaatgcgtttgttgtgtgggaagtcatccatttttccttcatgttgtatctacaggcaacattgctgtcgttccaattatcaaaaccatcggtttaggacttggaatcctaatctggggatcatttaacaccttaactggctgggcaagctcaaggtaacacagtccacactatctcagctacgagtcctgcatcctgcatttggtgtaaactgggatctagctatattgggagaaataacatgattcttggtctcagagtatggctggtacatgtaaatgaaccatgtctattatttgtctgaagctcttcataagtgatggagatattttatgaagatatagtaaaggaaataaaaagtaaaagctgtatctgggagacaagTGGGGAGAAAGGCAGCTCATGTCTGCTTTCTCCCTCTACTGCCTAACCAGGTACCTAAAGTAGATGCTCGACAATCTGTGGCTCGATCTCCCTGGGATTTTGTAAGATTTAGTGAGATGTAGCTATGTCAAAACACT
This mutation is a 501 bp deletion beginning at Chromosome 3 position 79,833,679 bp and ending after 79,834,179 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50927 | CAA CAC CAT CAG GGA TTT GG | Common | A | |||
| 50928 | GAA TGC ATC CTC TAA TAC TCA CTG | Wild type Reverse | A | |||
| 50929 | GTA CCT GGT TAG GCA GTA GAG G | Mutant Reverse | A | |||
| 50930 | Fluorophore-1 | AGG CAA TGG TTG TGA GAA TCT TAG | Quencher-1 | WT Probe | ||
| 50931 | Fluorophore-2 | CAA GTG GGG AGA AAG GCA G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50927 | 0.40 uM |
| 50928 | 0.40 uM |
| 50929 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.