For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:22051449+22051538 90bp TCTGAAAGGTTTTGGTCCATGT CTAACTTTCTTTGGAACTTTCCCC
Mut = 119 bp
Wt = 90 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CTTTCTGCCAGCATATTCTTTTTTTATAAGAAGTCTTACAATTTTTTAAAAGACTAAGGTAATTTATACATAGTCTAATTTTGATTTTTCAACATAATTTTATAGATATTCAATATCTGAATTTTTCTTAGATTAAAATGCTAAATATGAAATGTTAAGCTTTTGAGTCAGAGTTGAATTTTAGTTATTCTGAGTATAAGCATTTTGCTACGAACAATGTTACTTGTGTGTTAGAGTTTAAATCATCACACTctttactggaaggagctaaatgttgtttaatgtttttaggtggtttgaactcctgggatctgttcatttgcctgccttctagggaagctgatgggaaaccctgcatacccagggagcacatgtgtcgactaagcctacatcaaagggtaaatactgccaaagcataaacacattttatcagtcctatggattaaatctgaaaggttttggtccatgtattgttgcttttaatttttgaagaattggaaccactgtatctgTGGGGAAAGTTCCAAAGAAAGTTAGTTAGCTTTCTGGTACTATAACAAAATACCTGAGATAAACCGGCATATAAAGAAGGAAGATTGACCTTTGACCCACAGTTTCAGAGTTTCAGGCCATGGTCATTTGGCCTTGCTGACTTTGTCCATGTGTTGAGGCTGTACAACATGAATGGAGTCTG
This mutation is a 260 bp deletion beginning at Chromosome 6 position 22,051,254 bp and ending after 22,051,513 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50917 | CTA ACT TTC TTT GGA ACT TTC CCC | Common | A | |||
| 50918 | TCT GAA AGG TTT TGG TCC ATG T | Wild type Forward | A | |||
| 50919 | GCT TTT GAG TCA GAG TTG AAT TTT AG | Mutant Forward | A | |||
| 50920 | Fluorophore-1 | TTT GAA GAA TTG GAA CCA CTG TAT C | Quencher-1 | WT Probe | ||
| 50921 | Fluorophore-2 | TGC TAC GAA CAA TGT TAC TTG TGT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 50917 | 0.50 uM |
| 50918 | 0.50 uM |
| 50919 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.