For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:76652261+76652355 95bp GTCATGGAGAGCATCCGAAC AAGCCCTGAGTGTATCTTACCC
Mut = 96 bp
Wt = 95 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TAGAAAACTAAACAAGTCGTGCCTCCACTCTATAGAGCAAGAAAAACAACTGAAGAGAGAGGCAAATTAGTCAAGTGATTTTGTTTCTATTTTCTGATTTTCATTATTCCTACctcagattcacacacgtcattaagatgggccttaaataacacaaaaaggtaccttcagtcacatgatcacatattagagcatcttagacacatgtctttttttattctagaaaaattaactttgaccacagtttgatccgccaatcaaggagcagcaggaaggcggtgctgtgcgtggtcatggagagcatccgaaccacacgccagtgctctctgtcagtgcacgctgggattcgtggggaagccatgcgggtaagatacactcagggcttcactaacgacacagttactatggagtttaaaaaaaaattactcatcaaaggcagaaaaaaaaaaaaaaaaaaagagcctcagttttgtagggcttcagtccggagtggctgtgctttggaataagaaaaccaaccaaaaccacttgggttctaaccctgtgtgctacggtacaaacaatatattactggagtctctccaattaactactacctcagtgttagagtaacCACATAAAGTAAGCCTTGATGTCGTATGCTTTGACATTTATTTATTTATTTATTTATTTATTGTTTTTTGAGAAAGGGTTTCTCTGTGTAGCCCTAGGCTATCCTGG
This mutation is a 500 bp deletion beginning at Chromosome 2 position 76,652,084 bp and ending after 76,652,583 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50905 | GTC ATG GAG AGC ATC CGA AC | Wild type Forward | A | |||
| 50906 | AAG CCC TGA GTG TAT CTT ACC C | Wild type Reverse | A | |||
| 50907 | CTG AAG AGA GAG GCA AAT TAG TCA | Mutant Forward | A | |||
| 50908 | AAA GCA TAC GAC ATC AAG GCT TAC T | Mutant Reverse | A | |||
| 50909 | Fluorophore-1 | CTC TGT CAG TGC ACG CTG G | Quencher-1 | WT Probe | ||
| 50910 | Fluorophore-2 | TTT CTG ATT TTC ATT ATT CCT ACC ACA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50905 | 0.40 uM |
| 50906 | 0.40 uM |
| 50907 | 0.40 uM |
| 50908 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.