For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:5070062+5070154 93bp AAGCCTGGGCTGTCATTG AACTCTGACAATGTTGGAAAGG
Mut = 93 bp
Wt = 93 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
ATTGCCCATAAGAGTCCACTTTGATTTGTACTCTTGGAGACTAATGTCACTTCATCAGAAAGCCTGGGCTGTCATTGCCACgtaacttagttgacctaacttttctatgctggcttctcagcagttggtccctttccaacattgtcagagtttatgatagtgtgcttgctatctgctgggtgcgaggatattgctttctagagtgtgagcttctagaagctatctggtagtgcttgttcccattgttcattatgggtttggtactatgtttgtttatataagtgggaggaaagttaagagtcttgggggctggtctagtcccaacctaccccttagctctgttgtttctcttccttcagttccggtcagtggatgagacgacccaggccatggcatttgatggcatcatcttccagggccagtcattgaagattcgaaggcctcatgactatcagccattgcctggcatgtcagagaacccctctgtttatgtgcctggtgagtgggaattcgttgggtgggtggtatggggagtcactgtttcctcaacccaggttcctgtacttaGTCCAGCTAGAGTTGCTTTGGAGATAGTGTGTGTGCGCTGTGGATGTTCTTCTAGCTTGGCAGGTGTCCTGGGCCTTTGAGGTGGTGATCTGTGATCTTCAATCTTAAAGTTTAGCTTAGCTTGTAAATGTCAGAGCCAGGTCCAGATCAGAGGTGTCCTGGAAAGTGTGGGACTTGCAGTCTGGGCATTGTTTTTACCTTGTCCCCTTAGCCCTGGGATTTTAGGGCTTGATGTGTTGT
This mutation is a 486 bp deletion beginning at Chromosome 7 position 5,070,084 bp and ending after 5,070,569 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50900 | AAG CCT GGG CTG TCA TTG | Common | A | |||
| 50901 | AAC TCT GAC AAT GTT GGA AAG G | Wild type Reverse | A | |||
| 50902 | CAG GAC ACC TGC CAA GCT A | Mutant Reverse | A | |||
| 50903 | Fluorophore-1 | CTA TGC TGG CTT CTC AGC AGT T | Quencher-1 | WT Probe | ||
| 50904 | Fluorophore-2 | ACG TCC AGC TAG AGT TGC TTT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50900 | 0.40 uM |
| 50901 | 0.40 uM |
| 50902 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.