For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:36053107+36053209 103bp AGGTCCCCAGGCAGAAAGAG GAGTCATTGGACAAAGATTGG
Mut = 117 bp
Wt = 103 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TAATCACTGAGCCATCTCTCCAGCCCCAGGCTGTCCCATCTTAAACAACATCTTTTTGAGATTTTGATGAAAAGAAAGCACCACAAAAGCTCTGACAGAATACTGAGGAGCGATGCATctgaggatggagagagtgaacatctctctgtgtcccccagctgccacgcagagcccagtgacttcccatgttcttacaggatggagggcagtgccgagtacatcctccctactgacacgagatacatcggggagatgaaggacggcatgttccacggagaaggaaccctgttcttccccagtgggagccgattcgacgccatctggaagaagggattggtggtgaaggtgacaagctggggcttgaaggaggtccccaggcagaaagaggccctgctatagccccttcccctccctgcctggtgcttaccatttcccatgtttcattCTGCCCAATCTTTGTCCAATGACTCTACGTCTTTAAAGTTCATGCTCCTCATTCTTAAACTAGGGGCAGTCATCTTGGCTATCAAGGGCTGCCACAATGGGTTACCCCCACCCCATCTTAAATTAGCATC
This mutation is a 327 bp deletion beginning at Chromosome 2 position 36,052,858 bp and ending after 36,053,184 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50895 | GAG TCA TTG GAC AAA GAT TGG | Common | A | |||
| 50896 | AGG TCC CCA GGC AGA AAG AG | Wild type Forward | A | |||
| 50897 | CAG GCT GTC CCA TCT TAA ACA | Mutant Forward | A | |||
| 50898 | Fluorophore-1 | CCC TGC CTG GTG CTT ACC | Quencher-1 | WT Probe | ||
| 50899 | Fluorophore-2 | AGA ATA CTG AGG AGC GAT GCA TC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50895 | 0.40 uM |
| 50896 | 0.40 uM |
| 50897 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.