For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:26646876+26646984 109bp AGTTGGGTATCAGAAGTTGACTG GGTGGAGACCTGCATTATGA
Mut = 95 bp
Wt = 109 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TACATGCACTATGGTATGTACATTTCCCCCCTCTAATAAATAAATAATTGCAGTAATTTTTTTTCTTTTAAAAGAAAAGAAAACTTAGTTGGGTATCAGAAGTTGACTGTCAGTATATGGAatataatttactatgaacccaaacctaaaacattgctgatcatagaggaagaaatcataatgcaggtctccacccaccccacccctgtcttctttcttttttctttctagacttcaagctcgcatcgctcataggatacaagaactggaaagtctgcctggttccttgccaccagatttacgcaccaaagcaaccgtggaactgaaagcacttcgcttactcaacttccaacgtcaggtaatacctttttcccccgtgatgtaggaaATCAATGTGATTGTTGCTAAGGTGTGACCTGGGAGCTTCCTCAAGTCTACCTGATCTTGTTATAAAGCTTAGTGAGATAGTGCGTCTTCAGACTGACAGCTCACGGCTGAGAGTGAGGAGTATGAACCGCTCGTT
This mutation is a 267 bp deletion beginning at Chromosome 19 position 26,646,911 bp and ending after 26,647,177 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49710 | ACA AGA TCA GGT AGA CTT GAG GAA G | Mutant Reverse | A | |||
| 49712 | AGT TGG GTA TCA GAA GTT GAC TG | Common | A | |||
| 49714 | Fluorophore-1 | ATG GAA TCA ATG TGA TTG TTG CTA AG | Quencher-1 | MUT Probe | ||
| 50858 | GGT GGA GAC CTG CAT TAT GA | Wild type Reverse | A | |||
| 50859 | Fluorophore-2 | CCA AAC CTA AAA CAT TGC TGA TCA TAG A | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49710 | 0.40 uM |
| 49712 | 0.40 uM |
| 50858 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.