For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:65929251+65929342 92bp TTCTAGGCTCTGGGTGCTTC CATCTGTGCCCAAGAGCTG
Mut = 92 bp
Wt = 92 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
ACGACACTGAACCGTACATCTAAAAATAGTTGAGATGGTAAGGTTTTACGTCCGGTATATTTCACCACAATGAAAAGTATATAGGATGGTAGTTACAGTCAGAgtgatcctgggtgtgattttcttcatttgccaaggcttggcagacagatggtttaaagtcgcgttatcgaacattgtgtctccagttctcattaaccaagatttaattcccaggattcctatgcaagctacgatgtcaatggaaatgattatgacccatccccgagatatgacgccagcaacgagaacaagtatgtcctttggtggctgctgtcctgactaagcttcctttctttgcaaagaggggccctgcagaagttctaggctctgggtgcttcacctgtctgggtgctgcctggggcatacctagGTCTCAGAAGCCACTCGAACACAGCTCTTGGGCACAGATGGCTTCCATGGAGTTAGTCTT
This mutation is a 309 bp deletion beginning at Chromosome 7 position 65,928,994 bp and ending after 65,929,302 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50714 | CAT CTG TGC CCA AGA GCT G | Common | A | |||
| 50715 | TTC TAG GCT CTG GGT GCT TC | Wild type Forward | A | |||
| 50716 | CCG GTA TAT TTC ACC ACA ATG A | Mutant Forward | A | |||
| 50717 | Fluorophore-1 | TGG GTG CTG CCT GGG | Quencher-1 | WT Probe | ||
| 50718 | Fluorophore-2 | AGG ATG GTA GTT ACA GTC AGA GTC TCA G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50714 | 0.40 uM |
| 50715 | 0.40 uM |
| 50716 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.