Protocol 37161: Probe Assay - Tktl2<em1(IMPC)J>Alternate 1
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr8:66513417+66513525 109bp CAAACCTCTGGATGCTGTCA ACACACAGCTTCACCAATGC

Mut = 115 bp

Wt = 109 bp

Fam = Mut

Hex = Wt

 

Sequence

MUT Sequence (junction in uppercase):

tgggacattgggacactgcaaaacaaagcggttgtgtgtgcgcacgcgcgcgcggcttaagaccaggggcgcatgcgcagactttccTGataggatgctaaataatcaacaggagtggggacaatgtacgtcgttgtcaaagttacttataaaagagctttctcaaagataaagatcaactttagcaagagtcgatagttggtttttt

This mutation is a 2265 bp deletion beginning at Chromosome 8 position 66,511,711 bp and ending after 66,513,975 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
50695 CAA ACC TCT GGA TGC TGT CA Wild type Forward A
50696 ACA CAC AGC TTC ACC AAT GC Wild type Reverse A
50697 GGG ACA CTG CAA AAC AAA GC Mutant Forward A
50698 TTG TCC CCA CTC CTG TTG A Mutant Reverse A
50699 Fluorophore-1 TGC CAA AGC CAC AGG TG Quencher-1 WT Probe
50700 Fluorophore-2 CAT GCG CAG ACT TTC CTG ATA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
50695 0.40 uM
50696 0.40 uM
50697 0.40 uM
50698 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.