For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:58536148-58536283 136bp GGGGTATAGTCAACAAAATCTCCA TGAAAACCATTGCTATTGACC
Mut = 136 bp
Wt = 136 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TCAGTAGATCTATATCTACTCATTAAGCAGATGAAGGCAAATAGAAGGGTGGGGTATAGTCAACAAAATCTCCAGATTAAATAAAATGTTTTATGGCTGGAGttgtgggaggatcaagttctcattttaaatgttaaaataaagttttggagtatgcattttttaggtcaatagcaatggttttcatctcaaaatgttcagaggagccatttaattaacaaatcttcttgcattgcttgttctgggccctgctgtgcttatcatccatgcagaacaaaattcttccttttttatgcttgaatactttctttctccacagacatttccactgggcctaggagatgggcaattctattcctggacagatggtctgagaagaaaagactggcatgactatgagagcattcagagagatgctttgcgctcaggtatggattcagcatcagacagagtggtgctgttacttcagtgtttggtttgtccctgctaagttcttatgtccgtttttcttctgcatgcactaaagttgtctgtcttatgggaacattggtaatcaacaagGGACAGAAACAGATGAATTCAAACAAAACAGACAAAACAAATAATGAACATCCTTTCCTTGGCTGCAGAGGAGGTCATTGCAAATGTGCAAATCTATATTGTCTTAGATTCCTTTTAAAATAATT
This mutation is a 459 bp deletion beginning at Chromosome 8 position 58,535,773 bp and ending after 58,536,231 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50637 | GGG GTA TAG TCA ACA AAA TCT CCA | Common | A | |||
| 50638 | TGA AAA CCA TTG CTA TTG ACC | Wild type Reverse | A | |||
| 50639 | TTT GCA ATG ACC TCC TCT G | Mutant Reverse | A | |||
| 50640 | Fluorophore-1 | TGG GAG GAT CAA GTT CTC ATT TTA AAT | Quencher-1 | WT Probe | ||
| 50641 | Fluorophore-2 | CTG GAG GGA CAG AAA CAG ATG AAT | Quencher-2 | Mutant Forward |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50637 | 0.40 uM |
| 50638 | 0.40 uM |
| 50639 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.