Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr11:115820986+115821119 134bp CCTGATAAAGCCGATTGTCC AGCCTTCTCCCACACCTCA
Mut = 120 bp
Wt = 134 bp
Fam = Mut
Hex = Wt
Wt Sequence (deletions in lower case):
GAGTGAAGGTGGGTGACTAGGCCCTTGTGGCTGTTCCCAGGTACCCTTCCTTCTGCTATGGCTCTGCCTCTGACCTTTGCCTCATCCTCTTGGCCAAGCTCTCCCAAATCCCATCTACGgtggcggcagcctgagtgaacggacccgcctcctgttctcacccacagctctgtcgtgtcaccttacgagcggcagcttaatttggatggttatgcccagtgcctggaggatgggtctggcaagaggaagaggagttccagctgtcggtaatccacctgctgctgccacccctgggagcacatgggcttaagaaggggcctgaggacacagccgagggtatacctcagttccagtggaatgtacgtgtcttacggacagtaacaagggacaaatgtgctcttttttctcccgtgtctctaaggtctgttaataagaagcccaaggtcctgcagaactccctgccgcccgtcagcctggcagcctccagctcacctgcctgtgaccagagtagccaatacccagaggagaagtctcaggactcaagccccaggcagggctcagagctccccttgcagttcctggggtcctcagagccttgctctgatctggccagggaagacgtggggtgtgaccgagagagtcacaaaatagagaatggagctaagggaacccctaagctacgctggaactttgagcagatctcattccccaacatggcctctgatagtcgccacactttcctgcctgctccagccccagagctgctcccagccaatgtcattgggcgagggacagatgctgagtcctggtgccaaaagctgaaccagcggagggagaagctctcccgtagagaccgggaacagcaagcagtggtccagcagttccgggaggatgttaacgcagatcccgaggtgcggggctgctccagctggcaggagtacaaggagctgctgcagaggcgacagacgcagaagagccagccccggcctccacacctatggggccagtccgttacccccttgctcgaccctgataaagccgattgtccaggtatccctttaccctgagctatacccctataggctgttgggagcagagagagacttctgaaagtggatgcttagacgAGGGCTGGCTAAGGCCTGAGGTGTGGGAGAAGGCTGTGCAGTGGGGTGGGACCTATATAGGCTGTTCCGTGGGTGGTGGTGGCAGCCACTGGGGACAGTTTCCTGATGAGTCATTGACCAGTGATTCCCGTGGGGGATGAAAG
This mutation is a 1008 bp deletion beginning at Chromosome 11 position 115,820,077 bp and ending after 115,821,084 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50627 | AGC CTT CTC CCA CAC CTC A | Common | A | |||
| 50628 | CCT GAT AAA GCC GAT TGT CC | Wild type Forward | A | |||
| 50629 | TCC CAG GTA CCC TTC CTT CT | Mutant Forward | A | |||
| 50630 | Fluorophore-1 | CCC TGA GCT ATA CCC CTA TAG GCT G | Quencher-1 | WT Probe | ||
| 50631 | Fluorophore-2 | TCC CAA ATC CCA TCT ACG AGG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50627 | 0.40 uM |
| 50628 | 0.40 uM |
| 50629 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.