For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:127723293-127723444 152bp CCTATCTCAAAAGGGAGTTCTGG GCCATCATTAAGTCCCTGACA
Mut = 153 bp
Wt = 152 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AATGGTACAGGCCTGCAATCCCAGCACTCAGGAGGCAGAGGCAAGTGAATCTCTTTGGGTTTGAGGCTACTCTGGTCTACATAGTGAGCTCCAGGACAGCCAGGGTTACACAGTAAGACCCTATCTCAAAAGGGAGTTCTGGGCATGACACAATCAATCAgccaggtaattttgccctgatttgaatacacaagacaggccacaaatgcctctttggacattgttggaataaatgaatgatgactcaaagtgtcagggacttaatgatggcccttttatatcccctagcaactcccctatgcctactgagcctgctgttgccacccctcagtcctgcggcccccatctccccatcagagcccatcggtcaagcctacagcctggctctctacatgcagaagaacacgtcagcactgctgcagacctatgtgagtgacattgggcatatgcaagggtcgggaatctgaggtgggcaggtgctcttagccagagacacatttacttgtgtggtcactgatggctgagtgatatcaagctggccagctctcttcccttaCTCCTGACCTCCTCATCTGCAAAGTTATGTGTTACTGGCATAATGTTATTGTGCCCTGTGTAAAGACTGTCCTTGTATTATTCAAATGCTGATATCTGTGCCCCATATCTGGCTGCAATCCTTATTC
This mutation is a 396 bp deletion beginning at Chromosome 7 position 127,723,008 bp and ending after 127,723,403 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50606 | CCT ATC TCA AAA GGG AGT TCT GG | Common | A | |||
| 50607 | GCC ATC ATT AAG TCC CTG ACA | Wild type Reverse | A | |||
| 50608 | CCA GAT ATG GGG CAC AGA | Mutant Reverse | A | |||
| 50609 | Fluorophore-1 | TGC CCT GAT TTG AAT ACA CAA GAC A | Quencher-1 | WT Probe | ||
| 50610 | Fluorophore-2 | TCA CTC CTG ACC TCC TCA TCT GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50606 | 0.40 uM |
| 50607 | 0.40 uM |
| 50608 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.