For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:88420606-88420698 93bp GTGAGAAAATGGGTCGCTTC GGATCTGCCTGATGATGTCC
Mut = 93 bp
Wt = 93 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TGTGATGCCAAGACCTAGGAAAGAGACAAAATTCAGAATGGTTGGTCCTACACACCGAGTAGGGGCTGATGTGTGGTGTGGTCAGCGTTGCTGTGTGGTGAGGAATGATttcagaagggcttgtcaaagacagaagtgcagagacaatgcactgggtcgtggacgcactgagccaggctgtttgaaggctaggcttcgctgaggtgagtgtcctgaagatacagcccgagaggtggacttggcagcctaggcaggaggggaaagcaatgctgtcctgaccttcctcacatctctcgcctgcccaaaccccaggtctccgggcacaatggaggacaaacggaacatccagatcatcgagtgggagcacctggacaagaagaagttctatgtgtttggtgttgctatgacaatgatgatcagggtcagcgtgtacccgttcaccctcatccgcacccgcctgcaggtccagaagggcaagagcctctaccacgggaccttcgatgcctttgtcaagatcctgcgagcagatggagtggcgggcctctaccgggggttcctggtcaacaccttcacactcatctccggccagtgctatgtcaccacttacgagctcacccggaagtttgtggcagactacagccagagtaacacagtcaaatcactcgtagccgggggctcggcctcccttgtggcccagagcatcacggtgccgatcgatgttgtctcccaacatctgatgatgcagcggaagggtgagaaaatgggtcgcttccaagtgcacgggaacctagagggacaaggggtgattgcctttggccagactaaggacatcatcaggcagatccttcgggctgacggtctccgaggcttctaccggggctatgtggcctcgctgctaacgtacatcccaaacagtgctgtctggtggcccttctaccacttctatgcaggtaagcaggggcttggaaggagagcacttactggtggggcgggggacacttgctcctggctgattttagagtggagatgagtacagagaggggaccagatcagccccactgagtgttgggatcactggtgtacgcccccagtcaagcccagccgagcccagcccaacccgagtttgctagcacctgtttcttctgcttagcgcagtatcgcacctcgacTTTGTGGTAAAGCTAAACTCTGTACTGACCCTTTGGGAGTACACTCTGGCAATCTGTTTTTTTTTTTTTTTGTTCTTGTGGTTTTGTGAGGCAGGGTCTCTCTGTT
This mutation is a 1060 bp deletion beginning at Chromosome 3 position 88,420,282 bp and ending after 88,421,341 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50595 | GTG AGA AAA TGG GTC GCT TC | Wild type Forward | A | |||
| 50596 | GGA TCT GCC TGA TGA TGT CC | Wild type Reverse | A | |||
| 50597 | ACC GAG TAG GGG CTG ATG T | Mutant Forward | A | |||
| 50598 | CCC AAA GGG TCA GTA CAG AGT | Mutant Reverse | A | |||
| 50599 | Fluorophore-1 | AAC CTA GAG GGA CAA GGG GTG A | Quencher-1 | WT Probe | ||
| 50600 | Fluorophore-2 | TGG TGA GGA ATG ATT TTG TGG TAA A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50595 | 0.40 uM |
| 50596 | 0.40 uM |
| 50597 | 0.40 uM |
| 50598 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.