For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:39647561-39647677 117bp CTGAGAGAGTTGCACTGTAGACCAAG TCTCTTTATAACAGGCTCACTGGA
Mut = 111 bp
Wt = 117 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TGTAAGAGGAGTTTGTGGGAAAGGCCCAGCACTGTCTTCTTCTCCAAGAGCCTAGTAGTCCTCTCCCTTCAATAAAACGGCTACATTCACTGTGTGAAGTCAGCGTCTAGAATAAcccttcagcttccagacagaatacacttccccgcgcagccccacccccagggaaattctgaaagcatcactggtttgagttgcttagattgggaccacagagcccaaatattctccctgtgaaatccgccgaggcatgcaagtggtccaagcacggtcccagcgggaaacaccaagtttggtcccagcttgttactcgtagctctgccaccacaaacccttgttgtctttgttattgttgtatttgttagatccaaggactgccctttgggagctgcctggccatcagtgatggccccgtccacaacagcacagggatccctttcttctacatgacagccaaggaccctgcggtggctgacctggtgaagaatcccacagcctcgctggtgctgccggagtctgagggggagttttgcaggtaaaggagggagggtttgtttctaggggtttgggcagaggtagaaggtgggctgtatggccactgtcataggaccttagatgtacattgacatccttctgagagagttgcactgtagaccaagctatctcacatgtattcatctgaaaacgtgaGGGTGCATGGGTTTTGACTTTCACTGGGGTGATACATCCAGTGAGCCTGTTATAAAGAGAAACTGTTGTCTGTTGGAATGTGTAGGCTACACTTAGCCTAGCAGACCTCTCTGCTCAGCC
This mutation is a 575 bp deletion beginning at Chromosome 1 position 39,647,621 bp and ending after 39,648,195 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50590 | TCT CTT TAT AAC AGG CTC ACT GGA | Common | A | |||
| 50591 | CTG AGA GAG TTG CAC TGT AGA CCA AG | Wild type Forward | A | |||
| 50592 | CCC TTC AAT AAA ACG GCT ACA | Mutant Forward | A | |||
| 50593 | Fluorophore-1 | ATC TCA CAT GTA TTC ATC TGA AAA CGT | Quencher-1 | WT Probe | ||
| 50594 | Fluorophore-2 | TCA GCG TCT AGA ATA AGG GTG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50590 | 0.40 uM |
| 50591 | 0.40 uM |
| 50592 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.