For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:83434239-83434381 143bp CAGGGCAGTCTTTAGTAGCACAG CCATGACAGAACAATCTATGCAG
Mut = 164 bp
Wt = 143 bp
Fam = Mut
Hex = Wt
Sequence
MUT Sequence (junction in uppercase):
taagtgcagcatttaacgtcagagtcttgattactgagcagctcagcagcatctgtccttatgcttctctctggaactagttgtcctttgctgatgtatgcatacacacttaatacttcCTtgttcccaggctagagggctctgctgcatagattgttctgtcatggcttctgcatcatcagttacactattcattctatttacaggaaagagtttgtgagtgcccagaatc
This mutation is a 3865 bp deletion beginning at Chromosome 8 position 83,434,286 bp and ending after 83,438,150 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50585 | CCA TGA CAG AAC AAT CTA TGC AG | Common | A | |||
| 50586 | CAG GGC AGT CTT TAG TAG CAC AG | Wild type Forward | A | |||
| 50587 | GTG CAG CAT TTA ACG TCA GAG T | Mutant Forward | A | |||
| 50588 | Fluorophore-1 | ACC CTT TAT TGA AGT TCT AGG GAA GG | Quencher-1 | WT Probe | ||
| 50589 | Fluorophore-2 | TGC ATA CAC ACT TAA TAC TTC CTT GTT CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50585 | 0.40 uM |
| 50586 | 0.40 uM |
| 50587 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.