For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:22172724-22172872 149bp TCTCCAGTTCTCACTGTCCTG GCATTCATCCTCTGAAAACA
Mut= 147 bp
Wt= 149 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
TTATAGGTTTAGCAAGAAAACACCATTTGATTACATTAATTTAATCAAAGAGAGAAAAAAAGCAGGTAAGGGCACTTACAGTGCCCTTCTTGCCTATGATAGATCTTTTTCTCACACTAGTCTTGGAGCCATTCCCAGTTTTCCTGAGGCAGGGTCTTACATAGTTGAGGCTAGCTGTGAATTCTGGATCCTTGTGCCTGTATCTACCTTAGTGCTGGACTTATAGGTGTGAGCTCTACGTGTGCTCGTCACTAGTTTCTGTTTCACATTCTCCTCTagtataaatatttatgcctgggccatctctttctgttttacttagatataaaagctgtaataaaagctcatcacaattttattattgcattacaagaatttttttagcaaaggaagttcttgtttcttttttattggctataaaataattccaaactacataattatttttttgtcttccaggaatccccttctggtcggaggaaagctcttgccaccagcagcattaacatgaaacagtacgcaagccccatgccaacacaaactgacgtcaagttaaaattcaagccgctgtctaagaaggtcgtgtctgccactctccagttctcactgtcctgtatcttccttcgggagggaaaagcaacgtaagtgactcccttCCCGTcttagtGGATGGGCGCAGGGCAGACATCCATGCACGCCAGCCCTTCTCCAGCTCTCTGCTTTGTTTTCAGAGGATGAATGCCCTTGTTATTTTAAAATCCTGTCTTGATTCTCCAGAGCAACAATGACATAAAAAGTGTAACTGTTACCATTTCAAAATCAGTATGAGTTGACCTAGTGATGTGCACCCCAGTCCCAGCACTCAAGGCAAAAACATTTGGTACCACTGGCTGCCATTTTTGTC
This mutation is a 379 bp deletion beginning at Chromosome 11 position 22,172,810 bp and ending after 22,173,188 bp (GRCm38/mm10). In addition, there is a 6 bp deletion CTTAGT 4 bp after the 379 bp deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48979 | GCA TTC ATC CTC TGA AAA CA | Common | A | |||
| 50477 | TCT CCA GTT CTC ACT GTC CTG | Wild type Forward | A | |||
| 50478 | AGT GCT GGA CTT ATA GGT GTG AG | Mutant Forward | A | |||
| 50479 | Fluorophore-1 | CCT TCG GGA GGG AAA AGC | Quencher-1 | WT Probe | ||
| 50480 | Fluorophore-2 | ATT CTC CTC TCC CGT GGA TGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48979 | 0.40 uM |
| 50477 | 0.40 uM |
| 50478 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.