For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:108980478+108980563 86bp ACTGTGTCGATGTGGTCAGC CCTTTCTCCAGGGCTAAGGA
Mut = 84 bp
Wt = 86 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TCGTAAGCCGCTTGCAGGAGTCAAGTGTGTACTGGACATCCTCCCAGGAGCCTCATCCCCGTGGAGAgccaggatgagggggaggggaaggtaccccttgcttaagaagaggttaccaccgccccccccgccccccccagctccttgagctctgaggctggcccctttctgggtctcagtcaactatggtctgactgggtgctctctccattccaggacaggtagcagactgtcgaaggcaggggcaggactgtgtcgatgtggtcagcaggtaggagcgggtgtgaaggctgagtggagacaggagatgctgtttccttagccctggagaaaggagacctgtgctttgctgtgaggaagagagactctagctgccagttagatgtgaaattgtgggaccccaacctcctggggttccttcatcacggtgactggtgctgcctgtctttgtttcccttgcaggtgtggaatgctgtggactcgggacactgcctgcagacctactctgtgcacagtgaggcagtaagggctgcacggtggtctccctgtggccggcgcatcctcagtggtggcttcgactttgccctgcacctaacagaccttgaaacaggtgtgtcctaacgtcctaactgtctctggtcagccagcagccccctcactggggaagcctcctcagcgggtcctgactgcagactgtctatggtgacggtgtggcagaggcctcaggacatgcctacggGCATGCAGATCATTTGCCAGCAGCACCACAGCTGTCTACAAAGCATTGGAAGCAGTCCTCTGCCAGTCAGCAAAGGACAGAGCCAAG
This mutation is a 672 bp deletion beginning at Chromosome 12 position 108,980,296 bp and ending after 108,980,967 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48376 | GCT TGC AGG AGT CAA GTG TG | Mutant Forward | A | |||
| 50470 | ACT GTG TCG ATG TGG TCA GC | Wild type Forward | A | |||
| 50471 | CCT TTC TCC AGG GCT AAG GA | Wild type Reverse | A | |||
| 50472 | GTG CTG CTG GCA AAT GAT CT | Mutant Reverse | A | |||
| 50473 | Fluorophore-1 | AGC GGG TGT GAA GGC TGA GT | Quencher-1 | WT Probe | ||
| 50474 | Fluorophore-2 | CTC ATC CCC GTG GAG AGC AT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48376 | 0.40 uM |
| 50470 | 0.40 uM |
| 50471 | 0.40 uM |
| 50472 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.