For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:152873024+152873123 100bp GGCTGAATAAGTGGCTATTTTAGGA TCCTTTTCTGTCTCTTTGTGG
Mut = 103 bp
Wt = 100 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TCCCAAGTGCTGGGAGTAATGGTAGGCTGAATAAGTGGCTATTTTAGGATACTTCTGCAGTAGTctgactaggtttttggtctcttgtagttgacaacacttaccacaaagagacagaaaaggaaaatcttcagaaacagtctatcccatcaaatgattgttcttccctggatgctaagagagctgtatcaggaaatactcctgtccagcctcagaggtaagagtggggcacaaaagtggatattactggttctgctcaatcaatatagtaactccacagattccttatgttacttcagtgtttatggattgtagctTGCGGGTTTAATTTATAGGTAAGTGCTTATAGACACTTAGTTGCTTGGTTAAGGCACATTCATTTCAAAGCCAAGATTCAAACTTGTCGGTCTGACTTTAAAAGGTGTGTATGGATACAATTGTTTTTCTGATGTCAGTTCTCTTTCTATCTCTTTTTAA
This mutation is a 253 bp deletion beginning at Chromosome 2 position 152,873,064 bp and ending after 152,873,316 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50320 | GGC TGA ATA AGT GGC TAT TTT AGG A | Common | A | |||
| 50321 | TCC TTT TCT GTC TCT TTG TGG | Wild type Reverse | A | |||
| 50322 | AAT GTG CCT TAA CCA AGC AA | Mutant Reverse | A | |||
| 50323 | Fluorophore-1 | CTA GGT TTT TGG TCT CTT GTA GTT GAC AAC | Quencher-1 | WT Probe | ||
| 50324 | Fluorophore-2 | ATG CGG GTT TAA TTT ATA GGT AAG TGC T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50320 | 0.40 uM |
| 50321 | 0.40 uM |
| 50322 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.