For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:10568508+10568623 116bp CTGTCCATTTCTTTTACAATGAGG ATGCCAAAGTCTGTGCTTAGG
Mut = 115 bp
Wt = 116 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GAGGCCACAGGCTTCTCCCTGGAAGGGCTGGTGGGCCTGCGTAGTGTGTGGTTTCTTAGACAGGTAAAGGTTAAGCCGCTCTTTGTTGCTCACTGGTTGAGTTGTGCTTGttactcggcggcctgtgctggcatttcctccagcccgagctcaccggttgcactttgtgttctctctcctagattatttgctgtctaataactatgtaaactcgatcattgtccataaatttgacttttccgacgaggagatcatggcgtattacatatcgttcctgaaaacgctttcattaaagctcaacaaccacactgtccatttcttttacaatgaggtgagtggcgcccagcaagtgtatgtgtcaagctagtccaagcgtggaggcctTTGCTCTACAAAGCACTTTCCTAAGCACAGACTTTGGCATACTTAAATAAAATTTTTTGTTTTAAAATATGTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGTGT
This mutation is a 274 bp deletion beginning at Chromosome 16 position 10,568,310 bp and ending after 10,568,583 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50159 | ATG CCA AAG TCT GTG CTT AGG | Common | A | |||
| 50160 | CTG TCC ATT TCT TTT ACA ATG AGG | Wild type Forward | A | |||
| 50161 | CCT GCG TAG TGT GTG GTT TC | Mutant Forward | A | |||
| 50162 | Fluorophore-1 | CCC AGC AAG TGT ATG TGT CAA GCT A | Quencher-1 | WT Probe | ||
| 50163 | Fluorophore-2 | TGG TTG AGT TGT GCT TGT TGC TC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50159 | 0.40 uM |
| 50160 | 0.40 uM |
| 50161 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.