For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = C, C
Wild type = G, T
>chr15:76540636+76540716 81bp GCACAGCCAGTCCTGATCC AAGAGCATGCCCAGCAGAG
Sequence
gcctggcacagccagtcctgatcccagcccatccttggcagGTCTCT(g/c)GCAGGGC(t/c)GTGTGGTCTGTCTCTGCTGGGCATGCTCTTGGGCTCCTACCTGATGACA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50109 | GCA CAG CCA GTC CTG ATC C | Forward | A | |||
| 50110 | AAG AGC ATG CCC AGC AGA G | Reverse | A | |||
| 50111 | Fluorophore-1 | TGG CAG GGC TGT GTG G | Quencher-1 | WT Probe | ||
| 50113 | Fluorophore-2 | TCG CAG GGC CGT GTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50109 | 0.40 uM |
| 50110 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.