For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:38387438+38387548 111bp GGGTAGAACCACACATGAGC CCATTCTCTAGGAAGGAGAGTTC
Mut = 103 bp
Wt = 111 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AATACTACATACAAGAAACAAAGTGTAAATTCTGTGTCCAAGAGACCTGTCTGGGTAGAACCACACATGAGCGGACCCTCTtctggtagataacggctgagaggatgtaggagccccatagtgtgagctactctgagagagaactctccttcctagagaatggacgcttgctttactgtcgagcacgaccatcaccaaatgtctgtttcaggaatatgaaaatgcaacgaaggaggaaaattgcaatccagaagtgtgggtgaacttggcctgcacctacttttttcttgggatgtataaacaagcagaagctgctgggtttaaaggtaaagtgagctttttatagatcacttttgacttaatggcctgtccattgCTGTAATCCCTACTGTCTTATGGTTAGTCTTTGCTTTGTACCTAGTTTTATCTTTGCTCCTAATGTGTGTGTCTTATAGATAATTCAATTTACAGTTGAAACT
This mutation is a 295 bp deletion beginning at Chromosome 6 position 38,387,467 bp and ending after 38,387,761 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50104 | GGG TAG AAC CAC ACA TGA GC | Common | A | |||
| 50105 | CCA TTC TCT AGG AAG GAG AGT TC | Wild type Reverse | A | |||
| 50106 | AGA CAC ACA CAT TAG GAG CAA AGA | Mutant Reverse | A | |||
| 50107 | Fluorophore-1 | CGG CTG AGA GGA TGT AGG AGC | Quencher-1 | WT Probe | ||
| 50108 | Fluorophore-2 | CCT CTC TGT AAT CCC TAC TGT CTT ATG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50104 | 0.40 uM |
| 50105 | 0.40 uM |
| 50106 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.