Protocol 36937: Probe Assay - Topors<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr4:40262264-40262414 151bp GAAATCCAGCTTGCCTTCAC GACACAAATGCCTGACTCTCC

Mut = 160 bp

Wt = 151 bp

Fam = Mut

Hex = Wt

Sequence

MUT Sequence (junction in uppercase):

 taaactatttaaagaatatgtaggctattatatggtatctaagagcctactgtgtgctggtacttccccaaaggTTgaacagttagttacgggcccagcttcagtggctgtagtctctcctcccccata

This mutation is a 3749 bp deletion beginning at Chromosome 4 position 40,259,541 bp and ending after 40,263,289 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
50088 GAA ATC CAG CTT GCC TTC AC Wild type Forward A
50089 GAC ACA AAT GCC TGA CTC TCC Wild type Reverse A
50090 TTG TTT GCT GCT GAG CTT ATG Mutant Forward A
50091 GAG AGA CTA CAG CCA CTG AAG C Mutant Reverse A
50092 Fluorophore-1 TGG AGC CCA TGG TTC GCT A Quencher-1 WT Probe
50093 Fluorophore-2 TGT GTG CTG GTA CTT CCC CAA AG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
50088 0.40 uM
50089 0.40 uM
50090 0.40 uM
50091 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.