Protocol 36932: Probe Assay - Pygm<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr19:6389271+6389355 85bp ACCCCTACAGGAGCCATTCT GTCCACAGTCCTTGTTCAGC

Mut = 84 bp

Wt = 85 bp

Fam = Mut

Hex = Wt

Sequence

MUT Sequence:

cccggtaacttacgcaagccttgaacttgtgatcctctggtcgtagcttctccagtgacagggcttctgggaacccagctagtaagccTCttctgggggctggtgaccacccttagaagatgtggtattcccacatcttagtttcatttccttttgctgtc

This mutation is a 3639 bp deletion beginning at Chromosome 19 position 6,387,911 bp and ending after 6,391,549 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
50071 ACC CCT ACA GGA GCC ATT CT Wild type Forward A
50072 GTC CAC AGT CCT TGT TCA GC Wild type Reverse A
50073 CTC CAG TGA CAG GGC TTC TG Mutant Forward A
50074 TGG GAA TAC CAC ATC TTC TAA GG Mutant Reverse A
50075 Fluorophore-1 AGG GTC TCC TTC ATA GTG TGA GGA G Quencher-1 WT Probe
50076 Fluorophore-2 AGC TAG TAA GCC TCT TCT GGG GG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
50071 0.40 uM
50072 0.40 uM
50073 0.40 uM
50074 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.