For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:181683384+181683467 84bp AGAGAGGTGGGAGGTAGGTC AGTGGACAGCTGGGGAATG
Mut = 82 bp
Wt = 84 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GGTCATAAGAGAGGTGGGAGGTAGGTCCCTGGGTCCCAAatagccattgggagagatgttttctgtccctgccattccccagctgtccactgtgggagccaagagtccttggtgaggatccgcctctggaacaggcccctccgcctctgactcaggccacttgtcttgcagtccacccgtgttgggatgtctgtcaatgctctgcgcaagcagagttcagatgaggagctcattgcacttgccaagtccctcatcaagtcctggaagaagctcttgggtgagtctcagaatgtaaagggaagctcttgctggtcagcacagcatagagtgctggctctgctaccctgattgaaactatatatggtgggatatgacaaacatagatcagaaaggactcatccctgggctggacatggatgaagatggtagaagatggatgtcatctgttgtgatggggaggtgatggcctgggatgtatgatcattgagacaagggtatATGCTGCAGAGGAGGTTTTCAGgctgcaggagGCCAACAGAAAAGGAGATCCAGGCAGGATGC
This mutation is a 459 bp deletion beginning at Chromosome 2 position 181,683,416 bp and ending after 181,683,874 bp (GRCm38/mm10). There is an additional 10 bp deletion (GCTGCAGGAG) 22 bp after the 459 bp deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49947 | AGA GAG GTG GGA GGT AGG TC | Common | A | |||
| 49948 | AGT GGA CAG CTG GGG AAT G | Wild type Reverse | A | |||
| 49949 | TCC TGC CTG GAT CTC CTT TTC | Mutant Reverse | A | |||
| 49950 | Fluorophore-1 | TTG GGA GAG ATG TTT TCT GTC CC | Quencher-1 | WT Probe | ||
| 49951 | Fluorophore-2 | TCC CAA ATG CTG CAG AGG AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49947 | 0.40 uM |
| 49948 | 0.40 uM |
| 49949 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.