For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:116972090-116972187 98bp GCTTGAGGGTGACCTGCTAC TCCCCCTTTTCACTTTCTTC
Mut = 101 bp
Wt = 98 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GCCTGGCGTAGTTGGCTTGAGGGTGACCTGCTACTTTCTCTGCAGGTCCATggctggggaaggacctcaccaactgcctgcatctggtcaaagaagaaagtgaaaagggggagggccagagaaggcaccaatggtggcaacgactgcttgttctgtatgagtctttcccaagggagtctggagccccggtccctcttggaggttgggaaactggaggcgggtgctgaggccgaggtgagcacccagaagagctggagctctgagaagaactggagcggcctctcccagggccccggcactgcttccagagagcagtctaacaaactctgcattcccaccgacgtgcatggagaaaaaaaaagcctgcaactcaaggagtttatctggtgcatggaggagtggcctatgcccgagacagttagcagcaaggccggcaggaaccccagcggaagccccgagcaagggctctccacccctgactcccttgcagccaaggctcttgtggttcttcccccgctgaaaagctctccccacaacttggacgtcctgagtaagaaaagcaggaatattttctggcagccggaagaaaaggtgctgagggtggaaaaagacgattgtatggcttgtgcagatggactgaaaggagtagacgggaaaggtgaaaagagacactttgagctggccagccacgtgaaggtcaccaacgtactgcctttcccacccactgcggcccagacccacctgctgtcagccgagtcccaaaggtgctgcctgcactggtccctcctgccccagaaaagcactgtgttcccacctaaccccagcgacatccactaccttgccaccctgcaggttttggggcaacagggaaagcaaagctgcagaactaggctcaaaaccaaggacacaaaacctcccaggaccactgccaagcatattatcacagaggccaagcagcaaaacaggccccacgtgctAGAAAGCAAAGTCTTCCCTAAACCTCTCTTGCCA
This mutation is a 926 bp deletion beginning at Chromosome 8 position 116,971,225 bp and ending after 116,972,150 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49930 | GCT TGA GGG TGA CCT GCT AC | Common | A | |||
| 49931 | TCC CCC TTT TCA CTT TCT TC | Wild type Reverse | A | |||
| 49932 | GGG GAT GAC AAC TCT GCT CA | Mutant Reverse | A | |||
| 49933 | Fluorophore-1 | TGG GGA AGG ACC TCA CCA AC | Quencher-1 | WT Probe | ||
| 49934 | Fluorophore-2 | TCT GCA GGT CCA TAG AAA GCA AAG T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49930 | 0.40 uM |
| 49931 | 0.40 uM |
| 49932 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.