For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:134245444-134245532 89bp TGGTCTTGTGTGTGGGTGTC CTTCATCTGGCGGGCTAAG
Mut = 89 bp
Wt = 89 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TGGTCTTGTGTGTGGGTGTCTCTCTGATCATGGGTCGCTctcggcggaccggcgcgcaccgagcacattccttagcccgccagatgaaggccaagaagcggcggccggacctggatgagattcatcgcgagctgaggccgcaggggctcccgcggcccaagccggagccggacgcggagcccgacccggacctgccagggggcggcctgcatcgctGTCTGGCTTGCGCGTGAGTCCAGCCTGGGGAGGAGCAGGGTCTGAGGTACT
This mutation is a 177 bp deletion beginning at Chromosome 4 position 134,245,317 bp and ending after 134,245,493 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49036 | GTA CCT CAG ACC CTG CTC CT | Mutant Reverse | A | |||
| 49740 | TGG TCT TGT GTG TGG GTG TC | Common | A | |||
| 49741 | CTT CAT CTG GCG GGC TAA G | Wild type Reverse | A | |||
| 49742 | Fluorophore-1 | CGC GCA CCG AGC ACA | Quencher-1 | WT Probe | ||
| 49743 | Fluorophore-2 | CAT GGG TCG CTG TCT GGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49036 | 0.40 uM |
| 49740 | 0.40 uM |
| 49741 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.