For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:74762488-74762603 116bp CCTTTCTGTGTGCAGTGGAG TGTGACCTCGGAACCACT
Mut = 100 bp
Wt = 116 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CCTGATGCCCTTTTCCTTTCTGTGTGCAGTGGAGCCTCtgaatgggaacctggtgaggaaagagtgtgcaaactcatgcacctccgactacagccagcagggccatgtcagcagtggttccgaggtcacacaatgctgccagactgacctatgcaacgagaggctggtcagcgctgcacctggacatgccctgctcagcagtgtcaccctgggcctggcaacgagcctcagcctgctcacTGTTATGGCTCTCTGCCTGTAATGTAC
This mutation is a 202 bp deletion beginning at Chromosome 15 position 74,762,378 bp and ending after 74,762,579 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49735 | CCT TTC TGT GTG CAG TGG AG | Common | A | |||
| 49736 | TGT GAC CTC GGA ACC ACT | Wild type Reverse | A | |||
| 49737 | GTG GGG ACA CTG ACG ACT AGA | Mutant Reverse | A | |||
| 49738 | Fluorophore-1 | TGG GAA CCT GGT GAG GAA AGA G | Quencher-1 | WT Probe | ||
| 49739 | Fluorophore-2 | CTC TGT TAT GGC TCT CTG CCT GTA AT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49735 | 0.40 uM |
| 49736 | 0.40 uM |
| 49737 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.